View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13540_low_11 (Length: 237)
Name: NF13540_low_11
Description: NF13540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13540_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 13877868 - 13878074
Alignment:
| Q |
13 |
aatatcgcatggtggctcgcatggtggcttgatccggaggaagagtagggttatggataattgtccacgatttatcgctaagattgtaaatttccagtga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13877868 |
aatatcgcatggtggctcgcatggtggcttgatccggaggaagagtagggttatggataattgtccacgatttatctctaagattgtaaatttccagtga |
13877967 |
T |
 |
| Q |
113 |
tgaaagagaaaagacaaagcgtttttcacggttgacattgagtttgacaactttgaaatcgttggtgttgtgtttggcaccgaaaccaatcaagtattct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13877968 |
tgaaagagaaaagacaaagcgtttttcacggttgacattgagtttgacaactttgaaatcgttggtgttgtgtttggcaccgaaaccaatcaagtattct |
13878067 |
T |
 |
| Q |
213 |
ggatgaa |
219 |
Q |
| |
|
||||||| |
|
|
| T |
13878068 |
ggatgaa |
13878074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University