View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13540_low_11 (Length: 237)

Name: NF13540_low_11
Description: NF13540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13540_low_11
NF13540_low_11
[»] chr1 (1 HSPs)
chr1 (13-219)||(13877868-13878074)


Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 13877868 - 13878074
Alignment:
13 aatatcgcatggtggctcgcatggtggcttgatccggaggaagagtagggttatggataattgtccacgatttatcgctaagattgtaaatttccagtga 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
13877868 aatatcgcatggtggctcgcatggtggcttgatccggaggaagagtagggttatggataattgtccacgatttatctctaagattgtaaatttccagtga 13877967  T
113 tgaaagagaaaagacaaagcgtttttcacggttgacattgagtttgacaactttgaaatcgttggtgttgtgtttggcaccgaaaccaatcaagtattct 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13877968 tgaaagagaaaagacaaagcgtttttcacggttgacattgagtttgacaactttgaaatcgttggtgttgtgtttggcaccgaaaccaatcaagtattct 13878067  T
213 ggatgaa 219  Q
    |||||||    
13878068 ggatgaa 13878074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University