View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13541_high_13 (Length: 335)
Name: NF13541_high_13
Description: NF13541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13541_high_13 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 47 - 167
Target Start/End: Complemental strand, 9970345 - 9970225
Alignment:
| Q |
47 |
acctcattgaacaaatcaagaaattcaacttaatacgactttcccttgaagtgtatcctaaggatacacggaatatggtttcttagtagaactccatcat |
146 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9970345 |
acctcattgaacaaatcaagaagttcaacataatacggctttcccttgaagtgtttcctaaggatacgcggaatatggtttcttagtagaactccatcat |
9970246 |
T |
|
| Q |
147 |
tcgcagcaatcattccaacct |
167 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9970245 |
tcgcagcaatcattccaacct |
9970225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 163 - 243
Target Start/End: Complemental strand, 9970141 - 9970061
Alignment:
| Q |
163 |
aaccttgggtactctaaaacaacatgactgatcacgacgtgtacgggaattattaataatgtcgtcaaaaacaataaaata |
243 |
Q |
| |
|
|||||||||||||||| | || |||| |||| ||||||||||| |||| |||| ||||||||||||| ||||| |||||| |
|
|
| T |
9970141 |
aaccttgggtactctataccagcatggctgaccacgacgtgtatgggagttatccataatgtcgtcaagaacaagaaaata |
9970061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 251 - 302
Target Start/End: Complemental strand, 101582 - 101530
Alignment:
| Q |
251 |
caaatgtgtgactttag-tttggttttggatatcttttgtaggctaaaattta |
302 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
101582 |
caaatgtgtgacttttggtttggttttggatatcttttataggctaaatttta |
101530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 251 - 297
Target Start/End: Complemental strand, 6617910 - 6617863
Alignment:
| Q |
251 |
caaatgtgtgactttag-tttggttttggatatcttttgtaggctaaa |
297 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| ||||||||| |
|
|
| T |
6617910 |
caaatgtgtgacttttggtttggttttggatatcttttataggctaaa |
6617863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University