View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13541_high_19 (Length: 312)
Name: NF13541_high_19
Description: NF13541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13541_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 11 - 298
Target Start/End: Complemental strand, 7760936 - 7760650
Alignment:
| Q |
11 |
gcagagatggagttgtacttgttctgataacttggttttctcacctcggacaacgacaaatcttcctttgctgaaagaatttaagctgtaatgcttcatt |
110 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7760936 |
gcagagatggagttgtacttgttgtgataacttggttttctcacctcggacaacgacaaatcttcctttgctgaaagaatttaagctgtaatgcttcatt |
7760837 |
T |
|
| Q |
111 |
atcagcgctacatgagtccccaagttgcttctactgctagtattaagtctgccccaagtaggattaaatcatgtccttgcactaaagcttccagattctg |
210 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7760836 |
atcagcgctacatgagtccc-aagtggcttctactgctagtattaagtctgccccaagtagggttaaatcatgtccttgcactaaagcttccagattctg |
7760738 |
T |
|
| Q |
211 |
aatgagtctctcagtatttaatgtttggccatttactaataatacattgaacacatgagtgcaaacgttgatcatccggcctttagaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7760737 |
aatgagtctctcagtatttaatgtttggccatttactaataatacattgaacacatgagtgcaaacgttgatcatccggcctttagaa |
7760650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University