View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13541_low_2 (Length: 234)
Name: NF13541_low_2
Description: NF13541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13541_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 32258341 - 32258144
Alignment:
| Q |
16 |
gagatgaagcatagggaggctgtatgggataaacaagttaaattgtttcagcttgcagatattctgatatgaatatgaaactctct--gaattataagtt |
113 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32258341 |
gagatgaagcacagggaggctgtatggggtaaactagttaaattgtttcagcttgcagatattctgatatgaatatgaaactctctctgaattataagtt |
32258242 |
T |
 |
| Q |
114 |
cagagcaaaacataaagtacaatgctttatagaagcaatggataattctatactgcttgcttaataatctttgctatattctacctagcggactcagt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32258241 |
cagagcaaaacataaagtacaatgctttatagaagcaatggataattctatactgcttgcttaataatctttgctatattctacctagcggattcagt |
32258144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University