View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13542_high_2 (Length: 215)
Name: NF13542_high_2
Description: NF13542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13542_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 6222422 - 6222600
Alignment:
| Q |
20 |
ccgtaagtatcagaggttttgacggcggtgagagacggaaagataccggaattctgtgggtgtgtggctaagttgacggtggcgaaggtgccactaccta |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6222422 |
ccgtaagtatcagaggttttgactgcggtgagagacggaaagataccggaattctgtgggtgtgtggctaagttgacggtggcgaaggtgccactaccta |
6222521 |
T |
|
| Q |
120 |
gcatcttacctcgaacccagttcttcatgtttttgttactacgagatttttggtttggtttggtgtgttactctatttt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6222522 |
gcatcttacctcgaacccagttcttcatgtttttgatactacgagatttttggtttggtttggtgtgttactctatttt |
6222600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University