View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13545_low_6 (Length: 260)
Name: NF13545_low_6
Description: NF13545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13545_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 24 - 250
Target Start/End: Complemental strand, 43478987 - 43478760
Alignment:
| Q |
24 |
catttcactcatcactctttaaccccttacgagcataaggttcatccaaacaagaactgccttgctcaaagtcatcaccccttttcaagagtaacgactt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
43478987 |
catttcactcatcactctttaaccccttacgagcataaggttcatccaaacacgaactgccttgctcaaagtcatcactcattttcaatagtaacgactt |
43478888 |
T |
|
| Q |
124 |
ggggg-ctactgttattgactgataaaaagcataagacccatttctgtggacccaatcagaccaagcccgatcttatttgcaacacaccccctccctgcg |
222 |
Q |
| |
|
||||| |||||||| | ||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43478887 |
ggggggctactgttctggaccgataaaaagcataagacccatttatgtggacccaatcagaacaagcccgatcttatttgcaacacaccccctccctgca |
43478788 |
T |
|
| Q |
223 |
ggcgggggtttactctaacgtctctgtg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43478787 |
ggcgggggtttactctaacgtctctgtg |
43478760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University