View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13546_low_1 (Length: 354)
Name: NF13546_low_1
Description: NF13546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13546_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 12 - 336
Target Start/End: Complemental strand, 40033799 - 40033484
Alignment:
| Q |
12 |
cgaagaaaatatctaactatcctaaatgataagaacacatcaaatagaaatgaaattgtaccctaaattgtgcgaaagaaatttaccttgaatgaagtta |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40033799 |
cgaacaaaatatctaactatcctaaatgataagaacacatcaaatagaaacgaaattgtaccctaaattgtgagaaagaaatttaccttgaatgaagtta |
40033700 |
T |
 |
| Q |
112 |
ctcagaaaccctagaaccggtagagaaaatgaaatggtgagagaataaacagggttacatgatttatatggtgcagcgtcgtttttctttattttgacgg |
211 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033699 |
ctcagaaaccctaga---------gaaaatgaaatggtgagagaataaacagggttacatgatttatatggtgcagcgtcgtttttctttattttgacgg |
40033609 |
T |
 |
| Q |
212 |
aattgccctttgtttttgcatgcaccgccactctctgagccccctataatatactgccatgatttctggcttcaacacaaagctggttgagaaaacttat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033608 |
aattgccctttgtttttgcatgcaccgccactctctgagccccctataatatactgccatgatttctggcttcaacacaaagctggttgagaaaacttat |
40033509 |
T |
 |
| Q |
312 |
ttttggcaataactgatactatcat |
336 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
40033508 |
ttttggcaataattgatactatcat |
40033484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 270 - 316
Target Start/End: Complemental strand, 40039170 - 40039124
Alignment:
| Q |
270 |
atgatttctggcttcaacacaaagctggttgagaaaacttatttttg |
316 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40039170 |
atgatatctggcttcaacaccaagctggttgagaaaacttatttttg |
40039124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University