View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13547_high_15 (Length: 327)

Name: NF13547_high_15
Description: NF13547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13547_high_15
NF13547_high_15
[»] chr7 (1 HSPs)
chr7 (62-230)||(2494650-2494818)
[»] chr6 (1 HSPs)
chr6 (62-220)||(3683923-3684081)
[»] chr8 (1 HSPs)
chr8 (62-222)||(24181069-24181229)
[»] chr5 (1 HSPs)
chr5 (166-205)||(14021837-14021876)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 62 - 230
Target Start/End: Complemental strand, 2494818 - 2494650
Alignment:
62 agaatgtctcaaaaaccatgcagcaaacctaggtggtcatgccctagatggatgtggtgaattcatgacatcaccaacagcaacaccaaccgacccaaca 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
2494818 agaatgtctcaaaaaccatgcagcaaacctaggtggtcatgccctagatggctgtggtgaattcatgacatcaccaacagcaacaccaaccgacccaaca 2494719  T
162 tccttaaaatgtgctgcttgtggctgccaccgtaacttccaccgccgtgaaccagaagagccaccactc 230  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2494718 tccttaaaatgtgctgcttgtggctgccaccgtaacttccaccgccgtgaaccagaagagccaccactc 2494650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 62 - 220
Target Start/End: Complemental strand, 3684081 - 3683923
Alignment:
62 agaatgtctcaaaaaccatgcagcaaacctaggtggtcatgccctagatggatgtggtgaattcatgacatcaccaacagcaacaccaaccgacccaaca 161  Q
    |||||||||||||||||| |  |||| ||||||||||||||||||||| || ||| ||||||||||| |||||||||| || ||  |    |||||  |     
3684081 agaatgtctcaaaaaccacgtggcaaccctaggtggtcatgccctagacggttgttgtgaattcatgccatcaccaaccgccacctccgatgaccctgcc 3683982  T
162 tccttaaaatgtgctgcttgtggctgccaccgtaacttccaccgccgtgaaccagaaga 220  Q
    ||| |||||||||| || ||||| || ||||| || ||||||||||||||||| |||||    
3683981 tccataaaatgtgccgcatgtggttgtcaccggaatttccaccgccgtgaaccggaaga 3683923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 62 - 222
Target Start/End: Original strand, 24181069 - 24181229
Alignment:
62 agaatgtctcaaaaaccatgcagcaaacctaggtggtcatgccctagatggatgtggtgaattcatgacatcaccaac-agcaacaccaaccgacccaac 160  Q
    ||||||||||||||| ||||| |||  ||||||||| ||||| || ||||||||||||||||||||| || || || |   |||  ||||  ||||| |     
24181069 agaatgtctcaaaaatcatgctgcatccctaggtggacatgcacttgatggatgtggtgaattcatgccaccatcatctctcaatcccaa-tgaccctag 24181167  T
161 atccttaaaatgtgctgcttgtggctgccaccgtaacttccaccgccgtgaaccagaagagc 222  Q
    |||| | |||||||||||||||||||| ||||| || |||||||||||||| ||| ||||||    
24181168 atccctcaaatgtgctgcttgtggctgtcaccggaatttccaccgccgtgagccacaagagc 24181229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 166 - 205
Target Start/End: Complemental strand, 14021876 - 14021837
Alignment:
166 taaaatgtgctgcttgtggctgccaccgtaacttccaccg 205  Q
    |||||||||||||||||  |||||||||||||||||||||    
14021876 taaaatgtgctgcttgtaactgccaccgtaacttccaccg 14021837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University