View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13547_high_15 (Length: 327)
Name: NF13547_high_15
Description: NF13547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13547_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 62 - 230
Target Start/End: Complemental strand, 2494818 - 2494650
Alignment:
| Q |
62 |
agaatgtctcaaaaaccatgcagcaaacctaggtggtcatgccctagatggatgtggtgaattcatgacatcaccaacagcaacaccaaccgacccaaca |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2494818 |
agaatgtctcaaaaaccatgcagcaaacctaggtggtcatgccctagatggctgtggtgaattcatgacatcaccaacagcaacaccaaccgacccaaca |
2494719 |
T |
 |
| Q |
162 |
tccttaaaatgtgctgcttgtggctgccaccgtaacttccaccgccgtgaaccagaagagccaccactc |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2494718 |
tccttaaaatgtgctgcttgtggctgccaccgtaacttccaccgccgtgaaccagaagagccaccactc |
2494650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 62 - 220
Target Start/End: Complemental strand, 3684081 - 3683923
Alignment:
| Q |
62 |
agaatgtctcaaaaaccatgcagcaaacctaggtggtcatgccctagatggatgtggtgaattcatgacatcaccaacagcaacaccaaccgacccaaca |
161 |
Q |
| |
|
|||||||||||||||||| | |||| ||||||||||||||||||||| || ||| ||||||||||| |||||||||| || || | ||||| | |
|
|
| T |
3684081 |
agaatgtctcaaaaaccacgtggcaaccctaggtggtcatgccctagacggttgttgtgaattcatgccatcaccaaccgccacctccgatgaccctgcc |
3683982 |
T |
 |
| Q |
162 |
tccttaaaatgtgctgcttgtggctgccaccgtaacttccaccgccgtgaaccagaaga |
220 |
Q |
| |
|
||| |||||||||| || ||||| || ||||| || ||||||||||||||||| ||||| |
|
|
| T |
3683981 |
tccataaaatgtgccgcatgtggttgtcaccggaatttccaccgccgtgaaccggaaga |
3683923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 62 - 222
Target Start/End: Original strand, 24181069 - 24181229
Alignment:
| Q |
62 |
agaatgtctcaaaaaccatgcagcaaacctaggtggtcatgccctagatggatgtggtgaattcatgacatcaccaac-agcaacaccaaccgacccaac |
160 |
Q |
| |
|
||||||||||||||| ||||| ||| ||||||||| ||||| || ||||||||||||||||||||| || || || | ||| |||| ||||| | |
|
|
| T |
24181069 |
agaatgtctcaaaaatcatgctgcatccctaggtggacatgcacttgatggatgtggtgaattcatgccaccatcatctctcaatcccaa-tgaccctag |
24181167 |
T |
 |
| Q |
161 |
atccttaaaatgtgctgcttgtggctgccaccgtaacttccaccgccgtgaaccagaagagc |
222 |
Q |
| |
|
|||| | |||||||||||||||||||| ||||| || |||||||||||||| ||| |||||| |
|
|
| T |
24181168 |
atccctcaaatgtgctgcttgtggctgtcaccggaatttccaccgccgtgagccacaagagc |
24181229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 166 - 205
Target Start/End: Complemental strand, 14021876 - 14021837
Alignment:
| Q |
166 |
taaaatgtgctgcttgtggctgccaccgtaacttccaccg |
205 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14021876 |
taaaatgtgctgcttgtaactgccaccgtaacttccaccg |
14021837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University