View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13547_low_19 (Length: 278)

Name: NF13547_low_19
Description: NF13547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13547_low_19
NF13547_low_19
[»] chr1 (1 HSPs)
chr1 (14-121)||(7305859-7305966)
[»] chr2 (1 HSPs)
chr2 (14-124)||(1309623-1309733)
[»] chr5 (1 HSPs)
chr5 (51-121)||(11797174-11797244)
[»] chr3 (1 HSPs)
chr3 (14-109)||(37415410-37415507)


Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 14 - 121
Target Start/End: Original strand, 7305859 - 7305966
Alignment:
14 atatgagttgttttagaaaaatcaatggnnnnnnncttgggtttttaggtggaaagcgaaaatgagatgatgtagtgaataaattagtgttggtgaagat 113  Q
    |||||||||||| |||||||||||||||       ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
7305859 atatgagttgttgtagaaaaatcaatggtttttttcttgggtttttaggtggaaagcgaaaatgagatgatggagtgaataaattagtgttggtgaagat 7305958  T
114 gagcagat 121  Q
    ||||||||    
7305959 gagcagat 7305966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 14 - 124
Target Start/End: Complemental strand, 1309733 - 1309623
Alignment:
14 atatgagttgttttagaaaaatcaatggnnnnnnncttgggtttttaggtggaaagcgaaaatgagatgatgtagtgaataaattagtgttggtgaagat 113  Q
    |||||||||||| |||||||||||||||       ||||| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||    
1309733 atatgagttgttgtagaaaaatcaatggtttttttcttggatttttaggtggaaagtgaaaatgagatgatggagtgaataaattagtgttggtgaagat 1309634  T
114 gagcagataga 124  Q
    |||||||||||    
1309633 gagcagataga 1309623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 51 - 121
Target Start/End: Original strand, 11797174 - 11797244
Alignment:
51 tgggtttttaggtggaaagcgaaaatgagatgatgtagtgaataaattagtgttggtgaagatgagcagat 121  Q
    |||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||| ||||    
11797174 tgggtttttaggtggaaatcgaaaatgagaagatggagtgaataaattagtgttggtgaagatgagaagat 11797244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 14 - 109
Target Start/End: Complemental strand, 37415507 - 37415410
Alignment:
14 atatgagttgttttag--aaaaatcaatggnnnnnnncttgggtttttaggtggaaagcgaaaatgagatgatgtagtgaataaattagtgttggtga 109  Q
    |||||||||||| |||  ||||||||||||       |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||    
37415507 atatgagttgttgtagtgaaaaatcaatggtttttttcttgggtttttaggtggaaagcgaaaatgagaagatggagtgaataaattagtgttggtga 37415410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University