View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13547_low_20 (Length: 277)
Name: NF13547_low_20
Description: NF13547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13547_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 13 - 258
Target Start/End: Original strand, 2098771 - 2099016
Alignment:
| Q |
13 |
aatattgctagattaggctcatgatcatgcattagtctcttatgtactcactatagtaatcaatatgtgttatatggttgcacttaattttagcaagaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2098771 |
aatattgctagattaggctcatgatcatgcattagtctcttatgtactcactatagtaatcaatatgtgttatatggttgcacttaattttagcaagaac |
2098870 |
T |
 |
| Q |
113 |
tggattgtcattttgctgcttaataagaaagttatggtatgcagctttagggtgtaatttgcttaataagatagtttaagacttttcataaacaatctct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2098871 |
tggattgtcattttgctgcttaataagaaagttatggtatgcagctttagggtgtaatttgcttaataagatagtttaagacttttcttaaacaatctct |
2098970 |
T |
 |
| Q |
213 |
tcaattctagcttacaagtctttatatttttaccctaaccgttaac |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2098971 |
tcaattctagcttacaagtctttatatttttaccctaaccgttaac |
2099016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University