View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13548_low_6 (Length: 416)
Name: NF13548_low_6
Description: NF13548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13548_low_6 |
 |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 149892 - 149709
Alignment:
| Q |
1 |
gttgtttttgttgttgtgttggtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149892 |
gttgtttttgttgttgtgttggtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaagg |
149793 |
T |
 |
| Q |
101 |
tgaagaacttgcaccaccacttgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149792 |
tgaagaacttgcaccaccacttgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttg |
149709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 322 - 400
Target Start/End: Complemental strand, 149571 - 149493
Alignment:
| Q |
322 |
ctcctttgtcaccaaccatattgttgtcaaataaaaaatggttctaatggagagaggaaaagaaggaagtagaacaaac |
400 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149571 |
ctcctttgtcaccaaccatgttgttgtaaaataaaaaatggttctaatggagagaggaaaagaaggaagtagaacaaac |
149493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University