View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13549_high_3 (Length: 248)
Name: NF13549_high_3
Description: NF13549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13549_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 4 - 230
Target Start/End: Complemental strand, 7668631 - 7668405
Alignment:
| Q |
4 |
atgtcgaagaatatggcggcatcagtgtattgattgaatacttatttacttattgtctaaattatgttatcgttagttgcatgtttcttagtggtttgtg |
103 |
Q |
| |
|
||||| ||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7668631 |
atgtccaagtatacggcggcatcagtttattgattgaatacttatttacttattgtctaaattatgttatcgttagttgcatgtttcttagtggtttgtg |
7668532 |
T |
 |
| Q |
104 |
actgctgactccaaatattataccaaaacaatattgtatgaaacatgaagcacatgtgagttaatgtttgggttaagttaagaattgattcatcgataaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7668531 |
actgctgactccaaatattataccaaaacaatattgtatgtaacatgaagcacatgtgagttaatgtttgggttaagttaagaattgattcatcgataaa |
7668432 |
T |
 |
| Q |
204 |
acttggggcagatcgaggcaccgaaac |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7668431 |
acttggggcagatcgaggcaccgaaac |
7668405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University