View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355-INSERTION-2 (Length: 283)
Name: NF1355-INSERTION-2
Description: NF1355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355-INSERTION-2 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 8 - 283
Target Start/End: Original strand, 51933682 - 51933957
Alignment:
| Q |
8 |
aactaaccgtgtttatggggtccaagatttcagatgggactccatctattgctgttgggatctcaagcccaaacacttcagttttaatgtatttcgcatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51933682 |
aactaaccgtgtttatggggtccaagatttcagatgggactccatctattgctgttgggatctcaagcccaaacacttcagttttaatgtatttcgcatt |
51933781 |
T |
|
| Q |
108 |
caagagactgccagaatgaatggcatcaatgattttcctcgtgtacgctaacttgatccgattgcctgatccataactgccaaattacagggaagaaaaa |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51933782 |
caagagacagccagaatgaatggcatcaatgattttcctcgtgtacgctaacttgatccgattgcctgatccataactgccaaattacagggaagaaaaa |
51933881 |
T |
|
| Q |
208 |
ttagttttagtgaggaaaaaactaccatatatgcagttgcattgttagagttcacaccttccccctgaccagccag |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51933882 |
ttagttttagtgaggaaaaaactaccatatatgcagttgcattgttagagttcacaccttccccctgaccagccag |
51933957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University