View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355-INSERTION-7 (Length: 174)
Name: NF1355-INSERTION-7
Description: NF1355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355-INSERTION-7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 6e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 7 - 174
Target Start/End: Original strand, 8131585 - 8131752
Alignment:
| Q |
7 |
agggaattgttgatattgttgctgctgatgaatttgtaacgaatttggaaacctccattgttcaccaatgccatttgatatcaacaaagagccaccatta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8131585 |
agggaattgttgatattgttgctgctgatgaatttgtagcgaatttggaaacctccattgttcaccaatgccatttgatatcaacaaagagccaccatta |
8131684 |
T |
 |
| Q |
107 |
ccattaccaattgaagaagaaccactaccaagttgaaactcaacattagtagtagtactattgctcat |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8131685 |
ccattaccaattgaagaagaaccactaccaagttgaaactcaacattagtagtagtactattgctcat |
8131752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University