View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13550_high_2 (Length: 419)
Name: NF13550_high_2
Description: NF13550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13550_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 81 - 401
Target Start/End: Original strand, 2446410 - 2446741
Alignment:
| Q |
81 |
gtttataatgatataacggaaaagagaaaatggtgtagcgtgtgcgtggaaattggaatgattgaaagagtaaaatatgagtaatgtaagcatgtg---- |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2446410 |
gtttataatgatataacggaaaagagaaaatggtgtagcgtgtgcgtggaaattggaatgattgaaagagtaaaatatgagtaatgtaagcatgtgattg |
2446509 |
T |
 |
| Q |
177 |
--attgagaagctaaatctaaatccaaagcatagcgttcattttcattcattcatttattatcaattaatcaatcaatagtatattaataattctctacc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2446510 |
tgattgagaagctaaatctaaatccaaagcatagcgttcattttcattcattcatttattatcaattaatcaatcaatagtatattaataattctctacc |
2446609 |
T |
 |
| Q |
275 |
ttcactccactctcaaacttcaaagac-----aacataacacagtcaacaagtttggttccttattatcatcaaaacaatatcatgggacaaatcttcga |
369 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2446610 |
ttcactccactctcaaacttcaaagacaacataacataacacagtcaacaagtttggttccttattatcatcaaaacaatatcatgggacaaatcttcga |
2446709 |
T |
 |
| Q |
370 |
taaattacaaggttattttctttctttctttc |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2446710 |
taaattacaaggttattttctttctttctttc |
2446741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University