View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13550_low_4 (Length: 240)
Name: NF13550_low_4
Description: NF13550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13550_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 107 - 196
Target Start/End: Complemental strand, 56158427 - 56158340
Alignment:
| Q |
107 |
atataaaaataaatagatgagaaattaattattacatggatttggaatgtgtttgatctcagggaaaacatgtatgagatagagaatggt |
196 |
Q |
| |
|
||||||||||||| ||||||||||| | |||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
56158427 |
atataaaaataaagagatgagaaataa--tattacatggatttggaatgtgtttgatttcaggaaacacatgtatgagatagagaatggt |
56158340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 55763204 - 55763244
Alignment:
| Q |
47 |
agaagttttatgactaacttgagtaacgttttaccaatcta |
87 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
55763204 |
agaagttttatgactaacttgaataacgttttaccgatcta |
55763244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 55827584 - 55827624
Alignment:
| Q |
47 |
agaagttttatgactaacttgagtaacgttttaccaatcta |
87 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
55827584 |
agaagttttatgactaacttgaataacgttttaccgatcta |
55827624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University