View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13551_high_1 (Length: 364)
Name: NF13551_high_1
Description: NF13551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13551_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 77 - 345
Target Start/End: Complemental strand, 51225092 - 51224824
Alignment:
| Q |
77 |
ttcaagaattttttgtgcaagaaaagcctcttttttcaataccatcttctcctacttcaggaaatgaagaaattctctctactgtttcttactgcacctt |
176 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51225092 |
ttcatgaattttttgtgcaagaaaagcctcttttttcaataccatcttctcctacttcaggaaatgaagaaattctctctactgtttcttactgcacctt |
51224993 |
T |
 |
| Q |
177 |
tgttttcaccttcactgacccttcagaatcccctgcacaaagagactctaaaagacttcaactttcaaggctcattgctatgatgaaatcctcnnnnnnn |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51224992 |
tgttttcaccttcactgacccttcagaatcccctgcacaaagagactctaaaagacttcaactttcaaggctcattgctatgatgaaatcctcaaaaaaa |
51224893 |
T |
 |
| Q |
277 |
ccagtccatgagaaagttttaagacctttagtatcaatgatcaaagccaatcttttcaggccacttcct |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51224892 |
ccagtccatgagaaagttttaagacctttagtatcaatgatcaaagccaatcttttcaggccacttcct |
51224824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University