View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13552_low_4 (Length: 241)
Name: NF13552_low_4
Description: NF13552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13552_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 29007329 - 29007098
Alignment:
| Q |
1 |
ctcaacgacacaactgcacataacatcaaccctgtacaattcaaatgcaaatgtaatcaacaacatttacacaataaatacacttcgattataacttata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29007329 |
ctcaacgacacaactgcacataacatcaaccctgtacaattcaaatgcaaatgcaatcaacaacatttacacaataaatacacttcgattataacttata |
29007230 |
T |
|
| Q |
101 |
attcagcttaaacacgttttcttgtgt--tgtgcaatcgacacgtcaagagcaccgacacttgtgatcgaaaacgtatcagtgaattgta-cattgtcaa |
197 |
Q |
| |
|
||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
29007229 |
attcagcttaaacacatttttttgtgtgctgtgcaatcgacacgtcaagagcaccgacacttgtgatcgaaaacgtatc--tgaattgtatcattttcaa |
29007132 |
T |
|
| Q |
198 |
tatcctgatgcatgtgtttgtgtctgtgcttcat |
231 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
29007131 |
tatcctgatgcatgtgtttgtgtccgtgcttcat |
29007098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University