View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13552_low_5 (Length: 238)
Name: NF13552_low_5
Description: NF13552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13552_low_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 19318343 - 19318124
Alignment:
| Q |
18 |
gttgttttcgaaaaaattgcgtcaacttttacattgcaatcattttccaagttttatgaaatagaaggctcactaggttcttttgatgatataacccaga |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19318343 |
gttgttttcgaaaaa-ttgcgtcaacttttacattgcaatcatttcccaagttttatgaaatagaaggctcactaggttcttttgatgatataacccaga |
19318245 |
T |
|
| Q |
118 |
ttcacattttcaggaactgactacaataccaaaaacttttgctggatgctacaatatgaggttcattaatatccaagaatattgctgatgcgatcagatt |
217 |
Q |
| |
|
|||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19318244 |
ttcacatttttaggaacggactacaacaccaaaaacttttgctggatgctacaatatgaggttcattaatatccaagaatattgctaatgcgatcagatt |
19318145 |
T |
|
| Q |
218 |
ttagagcctatgaccctgacc |
238 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
19318144 |
ttagagcctatgactctgacc |
19318124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University