View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13553_high_2 (Length: 223)
Name: NF13553_high_2
Description: NF13553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13553_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 82 - 207
Target Start/End: Original strand, 39612697 - 39612822
Alignment:
| Q |
82 |
taggtgctgtatatcttccttaaaacagcttccctatgacaaaggacagtgcggtcagactgtaatataccatgcaaggtgtcaatagataatgtgctat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39612697 |
taggtgctgtatatcttccttaaaacagcttccctatgacaaaggacagtgcggtcagactgtaatataccatgcaaggtgtcaatagataatgtgctat |
39612796 |
T |
 |
| Q |
182 |
aacatgaaaaatttattattgtatgt |
207 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
39612797 |
aacatgaaacatttattattgtatgt |
39612822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University