View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13553_high_4 (Length: 214)

Name: NF13553_high_4
Description: NF13553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13553_high_4
NF13553_high_4
[»] chr5 (1 HSPs)
chr5 (15-214)||(9424287-9424486)


Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 214
Target Start/End: Complemental strand, 9424486 - 9424287
Alignment:
15 agagagaacaaaaacaatagttagcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcc 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9424486 agagagaacaaaaacaatagttagcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcc 9424387  T
115 taagttgaccaaagcagaagcaagcttgagacatctttcataggtttctcttcaagaaaatctaacacgatcattgtagatgatggaaactttgtcacca 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||    
9424386 taagttgaccaaagcagaagcaagcttgagacatctttcataggtttctctccaagaaaatctaacatgatcattgtagatgatggaaactttgtcacca 9424287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University