View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13553_high_5 (Length: 203)
Name: NF13553_high_5
Description: NF13553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13553_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 13645980 - 13646151
Alignment:
| Q |
18 |
gttagatagttaagg-tattgatatggagtaatcaaaatgatgacatttgtcaaacaacaaccgttgagatgcaagtgaagggggtacctgaaaacattt |
116 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
13645980 |
gttaaatagttaaggatattgatatggagtaatcaaaatgatgatatttgtcaaacaacaaccgttgagatgcgagtgaagggggtgcctgaaaacattt |
13646079 |
T |
|
| Q |
117 |
tgatgcttaagtaagtaagagcgcaagggtgagaggtattg-aaaatagaaattatgcatcttgtatttgtgatga |
191 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13646080 |
tgatgct----taagtaagagcgcaaaggtgagaggtattgaaaaatagaaattatgcatcttgtatttgtgatga |
13646151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University