View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13555_low_15 (Length: 338)
Name: NF13555_low_15
Description: NF13555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13555_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 138 - 335
Target Start/End: Complemental strand, 13147682 - 13147485
Alignment:
| Q |
138 |
tgttcatctaaccaatcatatgttgtcaaaggtagtgtctaagaactcattgaggtaaaaatttataatttcnnnnnnntgtttgatttgaaaatgcaaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
13147682 |
tgttcatctaaccaatcatatgttgtcaaaagtagtgtctaagaactcattaaggtaaaaatttataatttcaaaaaaatgtttcatttgaaaatgcaaa |
13147583 |
T |
 |
| Q |
238 |
gcctagtgttaatcatgcgaagtcaacaattattgatgtaaatgcatcacattctttannnnnnncataagaattaatactaaacttttttacatcaa |
335 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13147582 |
gtctagtgttaatcatgcgaagtcaacaattattgatgtaaatgcatcacattctttatttttttcataagaattaatactaaacttttttacatcaa |
13147485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 21 - 65
Target Start/End: Complemental strand, 13147806 - 13147762
Alignment:
| Q |
21 |
gcaattgtaatccggaaaatgttgatgaagaaatagcttttcaag |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13147806 |
gcaattgtaatccggaaaatgttgatgaagaaatagctttccaag |
13147762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University