View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13555_low_18 (Length: 250)
Name: NF13555_low_18
Description: NF13555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13555_low_18 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 40030306 - 40030541
Alignment:
| Q |
13 |
aatatcctgcacacacatgatttagatatattgttttgaaactagnnnnnnnnnattatcagctttcaaatttaaatcgtctgatcttgatccaacaaac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40030306 |
aatatcctgcacacacatgatttagatatattgttttgatactagttttttt--attatcagctttcaaatttaaatcgtctgatcttgatccaacaaac |
40030403 |
T |
 |
| Q |
113 |
ttacattatgcgttgaggattccaatcaatagaataggtgtgaaaattttgtgtgggatcaaaccaaagatagtactgcatctcacgacccccaacacca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40030404 |
ttacattatgcgttgaggattccaatcaatagaataggtgtgaaagttttgtgtgggatcaaaccaaagatagtactgcatctcacgacccccaacacca |
40030503 |
T |
 |
| Q |
213 |
ttggcataaatattggtttggagaatatatggttgacc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40030504 |
ttggcataaatattggtttggagaatatatggttgacc |
40030541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University