View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13555_low_20 (Length: 243)
Name: NF13555_low_20
Description: NF13555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13555_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 40030595 - 40030821
Alignment:
| Q |
1 |
aacttagctgcatatatacataagaaattaatcggacatacaataagtgaaagcccttatattatgctatgcattcatgcgcataagcataataatagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40030595 |
aacttagctgcatatatacataagaaattaatcggacatacaataagtgaaagcccttatattatgctatgcattcatgcacataagcataataatagtt |
40030694 |
T |
 |
| Q |
101 |
tcaaattgtggtacccgatcacctttacgtagtcaacacatcggtgatcattggataagatcaaacaatcaaaatttcaatcatggtattttcaaagttt |
200 |
Q |
| |
|
|||||||||||| | | ||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40030695 |
tcaaattgtggtgcacaatcacatttacgtagtcaacacgtcggtgatcattggataagatcagacaatcaaaatttcaatcatggtattttcaaagttt |
40030794 |
T |
 |
| Q |
201 |
aaaaattcaaaccatgcatgtaaaaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40030795 |
aaaaattcaaaccatgcatgtaaaaaa |
40030821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University