View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13555_low_23 (Length: 227)
Name: NF13555_low_23
Description: NF13555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13555_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 45312493 - 45312285
Alignment:
| Q |
1 |
atgaaatcaaacataaccaaatgtacagtctatgggaccattctattacgaggctatgtttatattaatctataggaccattcatgtatttagatatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45312493 |
atgaaatcaaacataaccaaatgtacagtctatgggaccattctattacgaggctatgtttatattaatctataggaccattcatgtatttagatatttt |
45312394 |
T |
 |
| Q |
101 |
gttgaactccaaatcaaccgataaaggatgaagttttgaacttgcttcttttcgaggaaaacctcgagattacttctaccacatatcattcaaaaccaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45312393 |
gttgaactccaaatcaaccgataaaggatgaagttttgaacttgcttcttttcgaggaaaacctcgagattacttctaccacatatcattcaaaaccaca |
45312294 |
T |
 |
| Q |
201 |
tctcacaca |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
45312293 |
tctcacaca |
45312285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University