View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13556_low_2 (Length: 252)
Name: NF13556_low_2
Description: NF13556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13556_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 137 - 246
Target Start/End: Original strand, 6068200 - 6068309
Alignment:
| Q |
137 |
tctagatgaatgtgaagccaagaaatatataatcaaattagtatatgatttgtgtagaataatggaagtaattatatcaggtggaattggatagggaagg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6068200 |
tctagatgaatgtgaagccaagaaatatataatcaaattagtatatgatttgtgtagaataatggaagtaattatatcaggtggaattggatagggaagg |
6068299 |
T |
|
| Q |
237 |
agttggacat |
246 |
Q |
| |
|
|||||||||| |
|
|
| T |
6068300 |
agttggacat |
6068309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 77
Target Start/End: Original strand, 6068076 - 6068140
Alignment:
| Q |
13 |
aaaatattgaaagacttaataaatgacctcatcttcaagcaataacactagagaattgtggatgg |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6068076 |
aaaatattgaaagacttaataaatgacctcatcttcaagcaataacactagagaattgtggatgg |
6068140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University