View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13557_high_1 (Length: 495)
Name: NF13557_high_1
Description: NF13557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13557_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 173 - 473
Target Start/End: Original strand, 13193124 - 13193424
Alignment:
| Q |
173 |
gacaaaatcaaccaactctccaacaccgcatcctccatctcccaccttggcatcccatcttaccaatggtggtctgaagccctccatggcattgcaacca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13193124 |
gacaaaatcaaccaactctccaacaccgcatcctccatctcccaccttggcatcccatcttaccaatggtggtctgaagccctccatggcattgcaacca |
13193223 |
T |
 |
| Q |
273 |
atggtcctggtgtcaacttcaatggatcagttaaatctgctacaaatttccctcaagttatcgtctccgccgcggcgtttaaccgttctctttggtttct |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13193224 |
atggtcctggtgtcaacttcaatggatcagttaaatctgctacaaatttccctcaagttatcgtctccgccgcggcgtttaaccgttctctttggtttct |
13193323 |
T |
 |
| Q |
373 |
tattggttatgctgttggtgttgaaggtagggctatgtttaatgtgggacaagctgggttgagtttttgggctccaaatgttaatgtttttagggatcct |
472 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13193324 |
tattggttatgctgttggtgttgaaggtagggctatgtttaatgtgggacaagctgggttgagtttttgggctccaaatgttaatgtttttagggatcct |
13193423 |
T |
 |
| Q |
473 |
a |
473 |
Q |
| |
|
| |
|
|
| T |
13193424 |
a |
13193424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 10 - 107
Target Start/End: Original strand, 13192961 - 13193058
Alignment:
| Q |
10 |
catcatcatcttcttgttttcactattactaatacacctccctaaattcttcaccaccccagattacccatgcaaaccaccacactctcactacccat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13192961 |
catcatcatcttcttgttttcactattactaatacacctccctaaattcttcaccaccccagattacccatgcaaaccaccacactctcactacccat |
13193058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University