View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13557_high_10 (Length: 267)
Name: NF13557_high_10
Description: NF13557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13557_high_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 11025546 - 11025275
Alignment:
| Q |
1 |
tttgttgatccaaagatcttttataaatagaatcagagagagtactttctaattacaat-----gatcgtctttatgcttgttttgattggttgtaagag |
95 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11025546 |
tttgttgatccaaaggtcttttataaatagaatcagagagagtactttctaattacaatataatgatcgtctttatgcttgttttgattggttgtgagag |
11025447 |
T |
 |
| Q |
96 |
cataatcatgatgagtcactataatttttgcaaaaactacattttagagctttacaaaaccaaggtacccgtgattttggcaatctaaacatccattcaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11025446 |
cataatcatgatgagtcactataattttggcaaaaactacattttagagctttacaaaaccaaggtacccgtgattttggcaatctaaacatccattcaa |
11025347 |
T |
 |
| Q |
196 |
acacactttatcgatcctcatctggttagataagtttttcaagatgtagaagaaaataatattttggactat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11025346 |
acacactttatcgatcctcatctggttagataagtttttcaagatgtagaagaaaataatattttggactat |
11025275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University