View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13557_low_7 (Length: 326)
Name: NF13557_low_7
Description: NF13557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13557_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 32824792 - 32824472
Alignment:
| Q |
1 |
agttttgtggattgtcaccttcatgtcaagaagaggtttagtttctttgtttgtggttcccatcccctatt----gaaaaatgatagcgagtgtgtttgt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
32824792 |
agttttgtggattgtcaccttcatgtcaagaagaggtttagtttctttgtttgtggttcccatcccctatctatcgaaaaattatagcgagtgtgtttgt |
32824693 |
T |
 |
| Q |
97 |
gtttttgttgggtccttnnnnnnnnnnnnnnnngttggtgtgatattgagatcagtgacaaagctagcataagnnnnnnnnnnnnnnn---gaaagaaaa |
193 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32824692 |
gtttttgttgggtcctttatatatata------gttggtgcgatattgagatcagtgacaaagctagcataagttttttttttttttttttgaaagaaaa |
32824599 |
T |
 |
| Q |
194 |
gctagcataaaatttagaatggggtttatcaaaaacattaagatggggtcaaatatcatcaattctatacctatctataaaagggattttatgacttgnn |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32824598 |
gctagcataaaatttagaatggggtttatcaaaaacattaagatggggtcaaatatcatcaattctatacgtatctataaaagggattttatgacttgaa |
32824499 |
T |
 |
| Q |
294 |
nnnnngaagaaggggtttgatgatgtc |
320 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
32824498 |
aaaaagaagaaggggttttatgatgtc |
32824472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University