View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13558_high_3 (Length: 283)
Name: NF13558_high_3
Description: NF13558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13558_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 35915976 - 35916237
Alignment:
| Q |
18 |
acttgggtttggattcaatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915976 |
acttgggtttggattcaatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagc |
35916075 |
T |
|
| Q |
118 |
cctgtttctacacctcaaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916076 |
cctgtttctacacctcaaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcc |
35916175 |
T |
|
| Q |
218 |
caggttaactttctttgcatttttcttaacaatcannnnnnngccttaatcctttgcttctc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
35916176 |
caggttaactttctttgcatttttcttaacaatcatttttttgccttaatcctttggttctc |
35916237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University