View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13558_low_3 (Length: 317)

Name: NF13558_low_3
Description: NF13558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13558_low_3
NF13558_low_3
[»] chr6 (3 HSPs)
chr6 (235-309)||(1956779-1956853)
chr6 (236-309)||(1941688-1941761)
chr6 (187-309)||(1927578-1927701)
[»] chr8 (1 HSPs)
chr8 (1-32)||(36774869-36774900)


Alignment Details
Target: chr6 (Bit Score: 67; Significance: 9e-30; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 235 - 309
Target Start/End: Complemental strand, 1956853 - 1956779
Alignment:
235 tttttaccttgatgccatgataaggaatatcacaaaagatgtctcactaattgcaaaaccctttatcttcatctc 309  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
1956853 tttttacctagatgccatgataaggaatatcacaaaagatgtctcactaattgcaaaaccctttatcttcttctc 1956779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 236 - 309
Target Start/End: Complemental strand, 1941761 - 1941688
Alignment:
236 ttttaccttgatgccatgataaggaatatcacaaaagatgtctcactaattgcaaaaccctttatcttcatctc 309  Q
    |||||||| |||||||||| |||||| || | ||||| ||||||||||||||||||||||||||||||| ||||    
1941761 ttttacctagatgccatgagaaggaagattaaaaaagctgtctcactaattgcaaaaccctttatcttcttctc 1941688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 187 - 309
Target Start/End: Complemental strand, 1927701 - 1927578
Alignment:
187 aatattatgaaggtataaacataaataaaacaaaacaagttttagt-attttttaccttgatgccatgataaggaatatcacaaaagatgtctcactaat 285  Q
    ||||||||||||||| |||||| ||||||| |||| || | | | | ||||||||||| |||||||||| ||| |||||   ||||| ||| ||||| ||    
1927701 aatattatgaaggtaaaaacatcaataaaataaaataattgtaatttattttttacctagatgccatgagaagaaatattgtaaaagctgtttcacttat 1927602  T
286 tgcaaaaccctttatcttcatctc 309  Q
    ||||||||||||||||||| ||||    
1927601 tgcaaaaccctttatcttcttctc 1927578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 36774900 - 36774869
Alignment:
1 atcacacttgttcttatgggatttaaaaatta 32  Q
    ||||||||||||||||||||||||||||||||    
36774900 atcacacttgttcttatgggatttaaaaatta 36774869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University