View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13559_low_10 (Length: 256)

Name: NF13559_low_10
Description: NF13559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13559_low_10
NF13559_low_10
[»] chr2 (3 HSPs)
chr2 (10-238)||(40643582-40643810)
chr2 (99-164)||(40639635-40639700)
chr2 (12-87)||(40639521-40639596)


Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 238
Target Start/End: Original strand, 40643582 - 40643810
Alignment:
10 aaaataaatcccctcaaagaatctcttgtcgtgcaaaagaagacaagaacccctcactctgaaattgataaattagaaactcttggtagtggtactccct 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40643582 aaaataaatcccctcaaagaatctcttgtcgtgcaaaagaagacaagaacccctcactctgaaattgataaattagaaactcttggtagtggtactccct 40643681  T
110 tgaaatgaattggccacaattgatgagatatcatgactaatgtagatggataaaaagnnnnnnnagtaatataaaacgcttctattatgcataggtgaat 209  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||    
40643682 tggaatgaattggccacaattgatgagatatcatgactaatgtagatggataaaaagtttttttagtaatataaaacgcttctattatgcataggtgaat 40643781  T
210 ctactccggtattgatttgatcggtgttt 238  Q
    |||||||||||||||||||||||||||||    
40643782 ctactccggtattgatttgatcggtgttt 40643810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 99 - 164
Target Start/End: Original strand, 40639635 - 40639700
Alignment:
99 tggtactcccttgaaatgaattggccacaattgatgagatatcatgactaatgtagatggataaaa 164  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||||    
40639635 tggtactcccttgaaatgaatttgccacaattgatgagctatcatgactaatgcagatggataaaa 40639700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 12 - 87
Target Start/End: Original strand, 40639521 - 40639596
Alignment:
12 aataaatcccctcaaagaatctcttgtcgtgcaaaagaagacaagaacccctcactctgaaattgataaattagaa 87  Q
    ||||||| |||||||||| |  |||||||||||||||||||||||||||||| ||| || ||||||||||||||||    
40639521 aataaattccctcaaagagtaccttgtcgtgcaaaagaagacaagaacccctgactgtggaattgataaattagaa 40639596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University