View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13559_low_9 (Length: 292)
Name: NF13559_low_9
Description: NF13559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13559_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 103 - 277
Target Start/End: Original strand, 35957475 - 35957650
Alignment:
| Q |
103 |
gtaaaccatcttcatactaacagaatatacaaattaaatccaaaaagaacaaatgaaggatgagttttaaaaaatatatagtttggcagtatctttattg |
202 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35957475 |
gtaaaccatcttcacactaacagaatatacaaattaaatccaaaaagtacaaatgaaggatgagttttaaaaaatatatagtttggcagtatctttattg |
35957574 |
T |
 |
| Q |
203 |
ttaaatgggcatgacatcagtcctaattttattc-ttagttataacaaggagtgatcatgttggagtatcaattct |
277 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35957575 |
ttaaattggcatgacatcagtcctaattttattctttagttataacaaggagtgatcatgttggtgtatcaattct |
35957650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 9 - 37
Target Start/End: Original strand, 35957380 - 35957408
Alignment:
| Q |
9 |
catatgaagtttgattcaatttagttttc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35957380 |
catatgaagtttgattcaatttagttttc |
35957408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University