View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_high_16 (Length: 339)
Name: NF1355_1D_high_16
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 123 - 318
Target Start/End: Complemental strand, 23029163 - 23028964
Alignment:
| Q |
123 |
tggaggaaaggtttataaatcgatgtatatttgaataatgtgtgtgagaga----aagattttgtgaaggaggggttagagatgatggagtatttaacct |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23029163 |
tggaggagaggtttataaatcgatgtatatttgaataatgtgtgagagagagagaaagattttgtgaaggaggggttagagatgatggagtatttaacct |
23029064 |
T |
 |
| Q |
219 |
atggttgctcaatcccaatttccaaatgaatgtcattatcaaagaatgaaattaagaggccccataattcatggacggtgatatcatttttggactttgt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23029063 |
atggttgctcaatcccaatttccaaatgaatgtcattatcaaagaatgaaattaagaggccccataattcatggacggtgataacatttttggactttgt |
23028964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University