View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_high_21 (Length: 295)
Name: NF1355_1D_high_21
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_high_21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 166 - 295
Target Start/End: Original strand, 37528949 - 37529078
Alignment:
| Q |
166 |
ggttatttgactgtataatagtactatactatagtattttagattagaattaannnnnnngcataaataaaagttatatagattagattaggattagata |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37528949 |
ggttatttgactgtataatagtactatactatagtattttagattagatttaatttttttgcataaataaaagttatatagattagattaggattagata |
37529048 |
T |
|
| Q |
266 |
tataggagtgcagtatcccgcgggatacac |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37529049 |
tataggagtgcagtatcccgcgggatacac |
37529078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University