View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_high_22 (Length: 293)
Name: NF1355_1D_high_22
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-150; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 7 - 290
Target Start/End: Original strand, 51403329 - 51403612
Alignment:
| Q |
7 |
ggcataggaacatccattgttcttagagccacaatctccaaaggtgcacaacctgtccctttccttgtcttcatgggtgttgctctctcaatcacagcat |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51403329 |
ggcataggaacatccgttgttcttagagccacaatctccaaaggtgcacaacctgtccctttccttgtcttcatgggtgttgctctctcaatcacagcat |
51403428 |
T |
 |
| Q |
107 |
ttcccgtcctcgctcgaatcctagctgagctcaaactgctaaccacggatgttggtcgtatagcaatgtcagcagctgctgttaatgatgttgcagcctg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51403429 |
ttcccgtcctcgctcgaatcctagctgagctcaaactgctaaccacggatgttggtcgtatagcaatgtcagcagctgctgttaatgatgttgcagcctg |
51403528 |
T |
 |
| Q |
207 |
ggtacttctcgctctagccatatcattatctggcgatgacacgtcgcccctgatttcactttgggttatgctctatgatactgc |
290 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
51403529 |
ggtacttcttgctctagccatatcattatctggcgatgacacgtcgcccctgatttcactttgggttatgctctgtggtactgc |
51403612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 67 - 221
Target Start/End: Complemental strand, 29983438 - 29983284
Alignment:
| Q |
67 |
ttccttgtcttcatgggtgttgctctctcaatcacagcatttcccgtcctcgctcgaatcctagctgagctcaaactgctaaccacggatgttggtcgta |
166 |
Q |
| |
|
|||||||| |||||||| ||||||||||| |||||||| ||||| ||||| ||||||||||||||||| |||||||| || || || ||||||||||| | |
|
|
| T |
29983438 |
ttccttgttttcatgggcgttgctctctcgatcacagcctttcctgtccttgctcgaatcctagctgaactcaaactcctcacaaccgatgttggtcgga |
29983339 |
T |
 |
| Q |
167 |
tagcaatgtcagcagctgctgttaatgatgttgcagcctgggtacttctcgctct |
221 |
Q |
| |
|
| ||||||||||| |||||||| ||||| || || || ||| ||||||| ||||| |
|
|
| T |
29983338 |
tggcaatgtcagctgctgctgtcaatgacgtcgctgcttggatacttcttgctct |
29983284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University