View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_14 (Length: 371)
Name: NF1355_1D_low_14
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 18 - 371
Target Start/End: Original strand, 47705183 - 47705536
Alignment:
| Q |
18 |
acatcactaaagggtaattgatagttatccgaaacaatcacagggacacatccagtgtttatagactccacaagtctagggctagctacttcatagccac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705183 |
acatcactaaagggtaattgatagttatccgaaacaatcacagggacacatccagtgtttatagactccacaagtctagggctagctacttcatagccac |
47705282 |
T |
|
| Q |
118 |
ttggacacaagcaaaacttgctttttcccatgagtttaaagtacttaagnnnnnnnggaagatattcatacactagtacttctttatcttttcctttcca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705283 |
ttggacacaagcaaaacttgctttttcccatgagtttaaagtacttaagtttttttggaagatattcatacactagtacttctttatcttttcctttcca |
47705382 |
T |
|
| Q |
218 |
ttgatctagtaatgtctttctaatcataccatgttcccctccagcaaagaaagcaagtatagaacgattatttgggtctttgcttggaattggtgagctc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47705383 |
ttgatctagtaatgtctttctaatcataccatgttcccctccagcaaagaaagcaagtatagaacgattatttgattctttgcttggaattggtgagctc |
47705482 |
T |
|
| Q |
318 |
aacttgtaaccttgtaggttcatttcaggcattgagacatctcttttaggatca |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705483 |
aacttgtaaccttgtaggttcatttcaggcattgagacatctcttttaggatca |
47705536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 102 - 139
Target Start/End: Complemental strand, 44629206 - 44629169
Alignment:
| Q |
102 |
gctacttcatagccacttggacacaagcaaaacttgct |
139 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
44629206 |
gctacttcataaccacttggacacaaacaaaacttgct |
44629169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University