View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_29 (Length: 308)
Name: NF1355_1D_low_29
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 9e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 144 - 302
Target Start/End: Original strand, 26915339 - 26915503
Alignment:
| Q |
144 |
tacaattacgttcaaatttcataatatcgtactcttgctctctttcacaagtgtattattattgggtatatagttttgtttggtgaaaaaatatggta-- |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26915339 |
tacaattacgttcaaatttcataatatcgtactcttgctctctttcacaaatgtattattattgggtatatagttttgtttggtgaaaaaatatggtaag |
26915438 |
T |
 |
| Q |
242 |
----agtattatgtctatgtcaacatattcgtggatgatataaactcgtctccatggcataccac |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26915439 |
taatagtattatgtctatgtcaacatattcgtggatgatataaactcgtctccatggtataccac |
26915503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University