View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_38 (Length: 282)
Name: NF1355_1D_low_38
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 95 - 199
Target Start/End: Complemental strand, 25708224 - 25708120
Alignment:
| Q |
95 |
aaagagtccttcatattgaagatagtactagtcaaatagaaaggtctaagtgggttttggattctcctaatccaccacctttatggaagaagctattttc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25708224 |
aaagagtccttcatattgaagatagtactagtcaaatagaaaggtctaagtgggttttggattctcctaatccaccacctttatggaagaagctattttc |
25708125 |
T |
|
| Q |
195 |
ttcat |
199 |
Q |
| |
|
||||| |
|
|
| T |
25708124 |
ttcat |
25708120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University