View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_41 (Length: 269)
Name: NF1355_1D_low_41
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 6 - 263
Target Start/End: Complemental strand, 30371461 - 30371204
Alignment:
| Q |
6 |
caaagaagcaaaggtaatgaaaatagatggagaaaccttcaagctaaaaactccagctaaagcaaacgatgtagttaaacactatcctggtcatgctctt |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30371461 |
caaaaaagcaaaggtaatgaaaatagatggagaaactttcaagctaaaaactccagctaaagcaaacgatgtagttaaacactatcctggtcatgctctt |
30371362 |
T |
 |
| Q |
106 |
ttggattcacaagcagtgaagcattttggtcttagggctaaaccacttgaacctcaccaacaactcaaggctaagaaaatctatttcttagttgagctac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30371361 |
ttggattcacaagcagtgaagcattttggtcttagggctaaaccacttgaacctcaccaacaactcaaggctaagaaaatctatttcttagttgagctac |
30371262 |
T |
 |
| Q |
206 |
caaaagttcagtctcaaccattgccgaggagggtgcgatccagtggattacacccttc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30371261 |
caaaagttcagtctcaaccattgccgaggagggtgcgatccagtggattacacccttc |
30371204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University