View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_45 (Length: 263)
Name: NF1355_1D_low_45
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 257
Target Start/End: Original strand, 26557410 - 26557653
Alignment:
| Q |
14 |
aagtgtaggttaaaagaagttcgtgaatattattgcatggtacaatgagtttgttagagatannnnnnnnnnnnngagggaagtttgttagagatatgta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26557410 |
aagtgtaggttaaaagaagttcgtgaatattattgcatggtacaatgagtttgttagagatattttttattttttgagggaagtttgttagagatatgta |
26557509 |
T |
 |
| Q |
114 |
gggaatgataattgcgtacttttatgcttttttaagtaatttataaaacgattccttcaaaagaaaattattaaatgatgttatcagaggttgattacct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26557510 |
gggaatgataattgcgtacttttatgcttttttaagtaatttataaaacgattccttcaaaagaaaattattaaatgatgttatcagaggttgattacct |
26557609 |
T |
 |
| Q |
214 |
ggacattagaaagaaagnnnnnnncaatgcatgtttgaaataaa |
257 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26557610 |
ggacattagaaagaaagaaaaaaacaatgcatgtttgaaataaa |
26557653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University