View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_47 (Length: 258)
Name: NF1355_1D_low_47
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 32 - 113
Target Start/End: Original strand, 1282615 - 1282696
Alignment:
| Q |
32 |
tacataaataacaagaaccatagctgaagcttaaagaactgtagaaattcgaaacagtcaaattttggtcatggtaatttcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1282615 |
tacataaataacaagaaccatagctgaagcttaaagaactgtagaaattcgaaacagtcaaattttggtcatggtaatttcc |
1282696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 32 - 113
Target Start/End: Complemental strand, 4125100 - 4125019
Alignment:
| Q |
32 |
tacataaataacaagaaccatagctgaagcttaaagaactgtagaaattcgaaacagtcaaattttggtcatggtaatttcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4125100 |
tacataaataacaagaaccatagctgaagcttaaagaactgtagaaattcgaaacagtcaaattttggtcatggtaatttcc |
4125019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 30 - 113
Target Start/End: Original strand, 49961128 - 49961211
Alignment:
| Q |
30 |
attacataaataacaagaaccatagctgaagcttaaagaactgtagaaattcgaaacagtcaaattttggtcatggtaatttcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49961128 |
attacataaataacaagaaccatagctgaagcttaaagaattgtagaaattcgaaacagtcaaattttggtcatggtaatttcc |
49961211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University