View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_51 (Length: 251)
Name: NF1355_1D_low_51
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 5242399 - 5242193
Alignment:
| Q |
1 |
gatgataccaaaatatgtgtaatattctaaatcattgaacattgtttaagttgaatagatgatttagaatacatatattttgaaattaaccgttgaagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5242399 |
gatgataccaaaatatgtgtaatattctaaatcattgaacattgtttaagttgaatagatgatttagaatacatatattttgaaattaaccgttgaa--- |
5242303 |
T |
 |
| Q |
101 |
tttgacagattgatataatcactctgtctgtcgtctaagctgtagggtttagttaaccataataccatatcatatcattatataata-taatggaacaac |
199 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
5242302 |
------agattgatataatcactttgtttgtcgtctaagctgtagggtttagttaaccataataccatatc--------atataatactaatggaacaac |
5242217 |
T |
 |
| Q |
200 |
atttaagtagcccaatgttacata |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5242216 |
atttaagtagcccaatgttacata |
5242193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University