View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_58 (Length: 238)
Name: NF1355_1D_low_58
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_58 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 5 - 238
Target Start/End: Complemental strand, 5242955 - 5242728
Alignment:
| Q |
5 |
tttggtgtttagatgccattgttttttctcaaatttggattggttgattatgctatgtagtgtcactttcttgatcagtaagtactcgaagctatgtggt |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5242955 |
tttgttgtttagatgccattgttttttctcaaatttggattggttgattatgctatgtagtgtcactttcttgatcagtaagtactcgaagct--gtggt |
5242858 |
T |
 |
| Q |
105 |
taaaacaaatggttaaggggtttatatagatatgtatcaaaatgtgacaaataaattaaataaataatgttgcatgacatgataatatttttagagtggt |
204 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5242857 |
taaaataaatggttaaggggtttatatagatat----caaaatgtgacaaataaattaaataaataatgttgcatgacatgataatatttttagagtggt |
5242762 |
T |
 |
| Q |
205 |
aaatatttgagaagatgacaacaaggtaaaaaag |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5242761 |
aaatatttgagaagatgacaacaaggtaaaaaag |
5242728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University