View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_59 (Length: 238)
Name: NF1355_1D_low_59
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_59 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 8 - 196
Target Start/End: Original strand, 24567115 - 24567303
Alignment:
| Q |
8 |
agattattctatgatttatgggtagctttaagagtcaataaaagttcagctctaaatttaatgctgctctagtctaaagtttcatggctatcagcagtta |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24567115 |
agattcttctatgatttatgggtagctttaagagtcaataaaagttcagctctaaatttaatgctgctctagtctaaagtttcatggctatcagcactta |
24567214 |
T |
|
| Q |
108 |
cctatgcacattatttgtgaagaaaagtttatataaaagttggcacaatctttctggtgatcctttaacttggtctaaaataaattata |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24567215 |
cctatgcacattatttgtgaagaaaagtttatataaaagttggcacaatctttctggtgatcctttaacttggtctaaaataaattata |
24567303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 36571304 - 36571254
Alignment:
| Q |
188 |
taaattatacatatatgttaccataatgtttatcttttcttatgggtgtga |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36571304 |
taaattatacatatatgttaccataatgtttatcttttcttatgggtgtga |
36571254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University