View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_61 (Length: 232)
Name: NF1355_1D_low_61
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 210
Target Start/End: Complemental strand, 49065451 - 49065251
Alignment:
| Q |
10 |
catagagtggtagtagagatgccatatttgcataacggtggtgaagatgattatgaagaaatgaggttgttcctgttgctgagaacatcgtcctccgtcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49065451 |
catagagtggtagtagagatgccatatttgcataacggtggtgaagatgattatgaagaaatgaggttgttcctgttgctgagaacatcgtcctccgtcc |
49065352 |
T |
 |
| Q |
110 |
tctttttgcaattgacctctctctcttgtgagcattttgatgtcccccaagtgcttgtgaactgaagaattttctcttgcagtagttgcaagtgaaaaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49065351 |
tctttttgcaattgacctctctctcttgtgagcattttgatgtcccccaagtgcttgtgaactgaagaattttctcttgcagtagttgcaagtgaaaaaa |
49065252 |
T |
 |
| Q |
210 |
c |
210 |
Q |
| |
|
| |
|
|
| T |
49065251 |
c |
49065251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 184
Target Start/End: Original strand, 2867116 - 2867194
Alignment:
| Q |
106 |
gtcctctttttgcaattgacctctctctcttgtgagcattttgatgtcccccaagtgcttgtgaactgaagaattttct |
184 |
Q |
| |
|
||||||||||||| ||||| |||||||| |||||||||||||| ||||| || | ||||||||| || |||||||||| |
|
|
| T |
2867116 |
gtcctctttttgctattgatctctctcttttgtgagcattttggtgtccacctaatgcttgtgagctatagaattttct |
2867194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University