View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_63 (Length: 229)
Name: NF1355_1D_low_63
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 89
Target Start/End: Original strand, 24056748 - 24056785
Alignment:
| Q |
52 |
cagcagcaaatgtaaacttggcataccccagcctcagc |
89 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24056748 |
cagcagcaaatgtaaactcggcataccccagcctcagc |
24056785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University