View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1355_1D_low_77 (Length: 211)

Name: NF1355_1D_low_77
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1355_1D_low_77
NF1355_1D_low_77
[»] chr5 (1 HSPs)
chr5 (1-193)||(25708202-25708394)


Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 25708202 - 25708394
Alignment:
1 atcttcaatatgaaggactctttgatctctcatagttgaagtgtttgggtgaactctcttgtcacactagtacttaatattgtacaataactttatgatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25708202 atcttcaatatgaaggactctttgatctctcatagttgaagtgtttgggtgaactctcttgtcacactagtacttaatattgtacaataactttatgatc 25708301  T
101 ggttaataaataccactaacatcattcaatttgcattgggatcaatttatgtgtatgattgattaattggggtggtggcagaaagagggctct 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25708302 ggttaataaataccactaacatcattcaatttgcattgggatcaatttatgtgtatgattgattaattggggtggtggcagaaagagggctct 25708394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University