View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_80 (Length: 203)
Name: NF1355_1D_low_80
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_80 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 23 - 130
Target Start/End: Complemental strand, 28430948 - 28430841
Alignment:
| Q |
23 |
cgtttctatgagaataggataattaagcctaaaaagaattcaaaaattgatcataattactctaatatagtagatacatacctgcatttgatcttgttca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28430948 |
cgtttctatgagaataggataattaagcctaaaaagaattgaaaaattgatcataattactctaatatagtagatacatacctgcatttgatcttgttca |
28430849 |
T |
|
| Q |
123 |
ctgctaac |
130 |
Q |
| |
|
|||||||| |
|
|
| T |
28430848 |
ctgctaac |
28430841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 125 - 191
Target Start/End: Complemental strand, 47368208 - 47368142
Alignment:
| Q |
125 |
gctaactactcaagaagcagacttactcacaaagcaaccgggaattctctcggttagccctgatgtc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47368208 |
gctaactactcaagaagcagacttactcacaaagcaaccgggaattctctcggttatccctgatgtc |
47368142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University